Discussion with a Creationist about
the Second Law of Thermodynamics
From toms Wed Jul 21 19:47:19 1999 To: twallace@trueorigin.org Subject: amazing Content-Length: 594 Dear Dr. Wallace: I find it amazing that you could write so much about the second law at http://www.trueorigin.org/steiger.htm and still not understand that the entropy of an unisolated system can increase, at the expense of the rest of the universe, of course. dS >= dq/T can just as easily be written -dS <= -dq/T. Are you intentionally ignoring this? Dr. Thomas D. Schneider National Cancer Institute Laboratory of Experimental and Computational Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov permanent email: toms@alum.mit.edu http://www.lecb.ncifcrf.gov/~toms/
Email number 2
From twallace@trueorigin.org Wed Jul 21 22:27 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id WAA02533 for
Email number 3
From toms Fri Jul 23 00:27:51 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Fri, 23 Jul 1999 00:27:51 -0400 (EDT)
In-Reply-To: <37968068.55C23A2D@trueorigin.org> from "Timothy Wallace" at Jul 21, 99 10:22:32 pm
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 1218
Dear Dr. Wallace:
> I have received your message, and would be delighted to provide a
> response to your excellent question. Before I do so, however, I would
> like your permission to post your questions, my response, and ensuing
> dialogue between us (if any), in the feedback portion of the
> TrueOrigin website.
>
> If you agree that questions of the caliber you have asked deserve to
> be posted in public view, please reply to this message indicating as
> much, and I'll gladly provide a response as soon as my schedule
> permits.
I will agree to your posting our discussion under the following conditions:
1. My complete messages are to be posted, without any modifications.
2. You may in addition quote portions of the message, but they must be in
proper context. If in any doubt, use complete sentences and no ellipsis.
3. I am allowed to post your messages on my web site. I may point to your
complete message but I may also quote portions in proper context.
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 4
From twallace@trueorigin.org Tue Jul 27 21:15 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id VAA13767 for
Email number 5
From toms Tue Jul 27 22:13:53 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Tue, 27 Jul 1999 22:13:53 -0400 (EDT)
In-Reply-To: <379E599A.FAAA30AA@trueorigin.org> from "Timothy Wallace" at Jul 27, 99 09:15:06 pm
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 112
Timothy:
> Thanks, but I have not earned the title "Dr".
Ok.
You didn't agree to the terms I proposed.
Tom
Email number 6
From twallace@trueorigin.org Tue Jul 27 22:50 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id WAA14557 for
Email number 7
From toms Wed Jul 28 00:10:09 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Wed, 28 Jul 1999 00:10:09 -0400 (EDT)
In-Reply-To: <379E6FAA.F6DE1ACD@trueorigin.org> from "Timothy Wallace" at Jul 27, 99 10:49:14 pm
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 4380
Tim:
> My apologies. I do agree to the terms you proposed.
Ok.
My original comlete question was:
| I find it amazing that you could write so much about the second law at
| http://www.trueorigin.org/steiger.htm and still not understand that the
| entropy of an unisolated system can increase, at the expense of the rest of
| the universe, of course. dS >= dq/T can just as easily be written -dS <=
| -dq/T.
You asked in return:
| I find it amazing that you could write so much about the
| second law ... and still not understand that the entropy
| of an unisolated system can increase, at the expense of
| the rest of the universe, of course...
|
| ...Are you intentionally ignoring this?
|
| It isn't clear to me what has given you the impression that I do not
| understand that the entropy of an unisolated system can increase, at
| the expense of it's surroundings, or that I am ignoring the fact.
|
| If you would care to site the specific passage(s) from my text in
| which it seems evident that I do not understand the above, I will be
| glad to address the matter with you, and (if necessary) adjust the
| text to eliminate any ambiguity concerning this issue.
Aha! My mistake! I meant to say:
The entropy of an unisolated system can DECREASE, at the expense of the rest
of the universe.
I presume you understood this error, or were intending to point it out.
The equations you deleted are critical, of course. dS >= dq/T is a form of
the Second Law of Thermodynamics.
S is the entropy. q is the heat put into the system (apparently the
direction harks back to the days when they were thinking about fires under
steam engine boilers) and T is the absolute temperature. Multiplying both
sides of the equation flips the signs and changes the direction of the
inequality. So -q is heat going out of a system, and it allows for the
decrease of the entropy of the system.
See:
http://www.lecb.ncifcrf.gov/~toms/paper/secondlaw/index.html
For more discussion. I've put it into html for you today.
That small paper also shows that one can derive from the above equation that
the total entropy is greater than or equal to zero. This is the common form
that people think about, but it is not the most general. The Second Law has
a great variety of forms; this was written up by the late Jaynes some time
ago. I'll see if I can get it on the web, because it is a wonderful
exposition ... I found it at his web site! :-)
Jaynes, E. T., 1988, ``The Evolution of Carnot's Principle'' in
Maximum-Entropy and Bayesian Methods in Science and Engineering, 1, G. J.
Erickson and C. R. Smith (eds.), Kluwer, Dordrecht, p. 267;
http://bayes.wustl.edu/
http://bayes.wustl.edu/etj/node1.html number 65
http://bayes.wustl.edu/etj/articles/ccarnot.pdf
http://bayes.wustl.edu/etj/articles/ccarnot.ps.gz postscript (56Kb) file.
I added the links to my little second law paper.
Also, the equation applies to non-equilibrium conditions.
So now we have the tools to look at some of the things that you wrote:
| Evolutionist theory faces a problem in the second law, since the law is
| plainly understood to indicate (as does empirical observation) that
| things tend towards disorder, simplicity, randomness, and
| disorganization, while the theory insists that precisely the opposite has
| been taking place since the universe began (assuming it had a
| beginning).
The Second Law does indeed indicate that things tend towards disorder. That
is the *total* entropy increases. Evolutionary theory does not say the
opposite. As you sit reading this message, you are burning food, and your
body is radiating heat, that is, -dS <= -dq/T. This heat is spreading out.
Indeed, it is the very act of it spreading out that allows you to live at
all, or for car engines to run. The heat eventually escapes to space. Of
course, fortunately, the sun provides a counterbalance.
There are plenty of other places from that point on in your text that express
the same misunderstanding, but I won't list them unless necessary. You can
clear them up yourself, and I can check your statements if you would like.
Regards,
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 8
From twallace@trueorigin.org Wed Jul 28 07:43 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id HAA18604 for
Email number 9
From toms Thu Jul 29 19:57:28 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Thu, 29 Jul 1999 19:57:28 -0400 (EDT)
In-Reply-To: <379EEC7B.525887CE@trueorigin.org> from "Timothy Wallace" at Jul 28, 99 07:41:47 am
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 7286
Tim:
> Actually, although I understood what you meant, I followed you in your
> error, mentally substituting "decrease" for "increase". No harm done.
OK, good.
> > > Evolutionist theory faces a problem in the second law,
> > > since the law is plainly understood to indicate (as does
> > > empirical observation) that things tend towards disorder,
> > > simplicity, randomness, and disorganization, while the
> > > theory insists that precisely the opposite has been taking
> > > place since the universe began (assuming it had a beginning).
> >
> > ...The Second Law does indeed indicate that things tend
> > towards disorder. That is the *total* entropy increases.
> > Evolutionary theory does not say the opposite. As you sit
> > reading this message, you are burning food, and your body is
> > radiating heat, that is, -dS <= -dq/T. This heat is spreading
> > out. Indeed, it is the very act of it spreading out that
> > allows you to live at all, or for car engines to run. The
> > heat eventually escapes to space. Of course, fortunately, the
> > sun provides a counterbalance.
>
> Your original issue had to do with your perception that I did not
> understand that the entropy of an unisolated system can [de]crease, at
> the expense of it's surroundings. I don't believe the passage quoted
> above denies this, nor does the balance of the essay, to my knowledge.
>
> I suppose it would be possible to interpret my paragraph (above),
> isolated as it is, as implying a misunderstanding that an unisolated
> system's entropy cannot decrease. But taken in the context of the
> balance of the essay, I believe my understanding is adequately
> clarified, and I do not (to my knowledge) deny the thermodynamic
> *possibility* of the entropy decrease you describe.
So you say that is a "*possibility*". The "*"'s suggest to me
that you think it is a low probability, but you are being vague here.
Do you mean:
1. Such decreases might happen once in a billion years (anywhere in the
universe).
2. Such decreases occur once per year on earth.
3. Such decreases occur millions of times per second inside every one of our
cells.
> Elsewhere, of course, I believe I do indeed make a distinction between
> the thermodynamic *possibility* of such an entropy decrease, and the
> *assumption* of a spontaneous, sustained decrease as a necessary (but
"Sustained" is perhaps misleading, as it is probably increases and
decreases, as we can discuss more later.
> unobserved) corollary to evolutionary theory. (This, in connection
Unobserved? By whom?
> with the Second Generalized Law.) I have no reason to believe that the
> former serves to substantiate (or render probable) the latter, except
> by defining it as thermodynamically "possible".
Again, this is too vague to mean anything.
> > There are plenty of other places from that point on in your
> > text that express the same misunderstanding, but I won't list
> > them unless necessary. You can clear them up yourself, and I
> > can check your statements if you would like.
>
> Please allow me to suggest that we continue focusing on the first
> paragraph you have cited before moving on. It is not my aim to be
> facetious or disrespectful, but I still do not see where the
> "misunderstanding" you describe is manifest in the cited paragraph.
As a focal point, I suppose we can do that. I'm however more concerned with
your general conceptions or mis-conceptions than with particular phrasings.
> Again, I do not mean to be difficult, but it is not wholly clear to me
> how the essay in general, or the above-cited paragraph in particular,
> indicates a failure on my part to understand that the entropy of an
> unisolated system can decrease at the expense of it's surroundings.
>
> I appreciate your patience in addressing this issue with me.
Ok, here we go:
********************************************************************************
> Evolutionist theory faces a problem in the second law,
No biologist, biochemist, physicist or thermodynamicist that I know (and I've
met hundreds) would agree with this statement. Nor do I. It is not a
conspiracy, it is based on our observations. I should add that if a
scientist could demonstrate clearly and conclusively that there was a
problem, they would do so very quickly and very publicly because they would
be on the fast track to a Nobel prize. So there is plenty of impetus to
knock the theory. (Besides, if there were a consipracy, you'd have to have
it cover millions of people around the planet, and leaks would be impossible
to stop.)
I should also add that just because a lot of people think one thing does not
make them right. Notice that this cuts both ways for scientists and
creationists.
> since the law is plainly understood to indicate (as does
> empirical observation) that things tend towards disorder,
This is incorrect.
Not everything tends to disorder. Crystal growth is a clear example of order
formation. So this is an incomplete statement of the Second Law. IN
PARTICULAR the form dS >= dq/T does not in itself say that the entropy of a
system (dS) cannot decrease. Straightening that double negative sentence out
(by multiplying by -1 on both sides!) we have -dS <= -dq/T, meaning that if
heat goes out of a system, its entropy can go down.
Have you read:
http://www.lecb.ncifcrf.gov/~toms/paper/secondlaw/index.html
yet? In particular, the part "Using the equation to derive a familiar form
of the Second Law" is relevant here.
> simplicity, randomness, and disorganization, while the
> theory insists that precisely the opposite has been taking
> place since the universe began (assuming it had a beginning).
The evolutionary theory does not go against the Second Law if the general
form of the Second Law is used and not a specific derivation. We will come
back to this later. However I think it would be more enlightening to
concentrate for a while on a specific experiment that everybody can do.
Have you ever made rock candy? Boil some water and when it is boiling, add
sugar and stir it in. Add so much sugar that you can't get more in. Then
let it settle and pour off the top part into a jar (you could also filter it
if you want). Suspend a string in the middle of the jar (not touching the
sides), and (perhaps) seal the top. Then put the jar in a calm place to cool
for a long time. (I'm not sure, but it may take weeks.)
a. What happens to the heat that was in the jar?
b. What happens inside the jar?
c. What happens if you boil the jar and its contents later on?
d. What are the heat flows in each of these steps?
e. How do the heat flows and effects inside the jar relate to the equation
dS >= dq/T?
Just to head you off at the pass, you need not object that "sugar" (ha!) is
not alive. We'll deal with that vitalistic viewpoint later (though you might
note that vitalism died about a century ago when urea was synthesized.)
If you haven't made rock candy, now is the time to do it! It's fun and
rather tasty ...
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 10
From twallace@trueorigin.org Thu Jul 29 22:46 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id WAA20714 for
Email number 11
From toms Fri Jul 30 02:07:26 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Fri, 30 Jul 1999 02:07:26 -0400 (EDT)
In-Reply-To: <37A111DA.10DE71A1@trueorigin.org> from "Timothy Wallace" at Jul 29, 99 10:45:46 pm
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 10158
Tim:
I am now archiving this series at:
http://www.lecb.ncifcrf.gov/~toms/twallace/
> > > I suppose it would be possible to interpret my paragraph (above),
> > > isolated as it is, as implying a misunderstanding that an unisolated
> > > system's entropy cannot decrease. But taken in the context of the
> > > balance of the essay, I believe my understanding is adequately
> > > clarified, and I do not (to my knowledge) deny the thermodynamic
> > > *possibility* of the entropy decrease you describe.
> >
> > So you say that is a "*possibility*". The "*"'s suggest to me
> > that you think it is a low probability, but you are being vague here.
>
> Sorry, I don't mean to be vague: I mean to emphasize that by being a
> "possibility" it is not also ipso facto an "inevitability," or
> "spontaneous," or a likely "causeless event." There is a significant
> difference between the two, and there is no basis for taking for
> granted that something that is thermodynamically possible is ipso
> facto highly probable, inevitable, or spontaneous in nature.
I'm interpreting your statements to mean that you think that entropy
decreases don't occur often. (We'll deal with relevancy later.)
> > Do you mean:
> >
> > 1. Such decreases might happen once in a billion years (anywhere in the
> > universe).
> >
> > 2. Such decreases occur once per year on earth.
> >
> > 3. Such decreases occur millions of times per second inside every one of our
> > cells.
>
> On what basis do you submit only these three possibilities? What
> cause do you have for attempting to limit my meaning in such a way?
There are plenty of other possibilities of course. I chose a huge range of
cases for you to chose from. You may fill in as many intermediates as you
chose, but probably 3 is enough for this discussion. By making concrete
examples, we won't get stuck on vague terminiolgy. In particular I'm
interested if you think that case 3 is true or false.
> You are perhaps missing the point: It is not an issue of guessing
> some random frequency of occurrence over time, as you seem to have
> intimated with the above arbitrary choices. That the entropy of an
> unisolated system *can* decrease (at the expense of it's
> surroundings), is no basis for assuming that it therefore *must* do so
> (without cause), nor for assuming that it therefore commonly and/or
> spontaneously *does* do so (without cause), or for compelling anyone
> (me, for example!) to accept or define a specific rate of frequency.
I get the feeling that you are thinking about the case where, for example,
there is a small probability that all the air in a room will go into one
corner, or that after a bottle of perfume has been opened that the odor will
go back into the bottle. The probability of such events is very small. But
it *can* occur and will occur if one waited long enough. But long is case 1
above, billions of years.
That's not what I was thinking about. I'm asking whether you think that
there are or are not regular occurances of entropy decrease. The scale I
made up makes "regular" something precise that we can agree, test and think
about.
> > > Elsewhere, of course, I believe I do indeed make a
> > > distinction between the thermodynamic *possibility*
> > > of such an entropy decrease, and the *assumption* of
> > > a spontaneous, sustained decrease as a necessary (but
> > > unobserved) corollary to evolutionary theory.
> >
> > Unobserved? By whom?
>
> Rather than ask me who did *not* observe such specific spontaneous
> decreases in entropy as would serve as a necessity -- and unequivocal
> evidence -- for the commencement and perpetuation of darwinian
> evolution as theorized today, it should be easier for you to rebut my
> position (if that is your intention) by citing exactly who *did*
> observe such decreases, and how these observations specifically and
> unequivocally substantiate the modern darwinian hypothesis. So,
> rather than answer your question(s) ["Unobserved? By whom?"], I
> invite you to answer mine:
>
> Observed? By whom?
Well it was a silly way to ask the question, but my point is that you were
implying that nobody has ever observed entropy decreases. The answer is that
everybody has observed it, as will be clear as we proceed with the question
of crystals. (Again, we will deal with relevancy later.)
> In the same way, while one may easily calculate the hypothetical
> entropy changes associated with the changes hypothesized in
> evolutionary theory, such calculations by themselves do not serve to
> substantiate evolutionary theory, since the hypothesized entropy
> changes are not directly affiliated with known, observable, mechanisms
> or processes which can be said to be unequivocal, compelling evidence
> for the initiation and perpetuation of the evolution process, whether
> with regard to heat entropy or informational entropy.
So does this mean that one should not rely on calculations of the orbit of a
satellite? Or whether a building will stand or an airplane will fly? Such
predictive calculations are used successfully all the time. We only hear
about the rare cases where someone goofed.
Also, the changes required for evolution to occur are associated with known
observable mechanisms, in particular base substitutions, effects of
radiation, transposons, illegitimate recombination and so on. The study of
mechanisms for generating sequence variation is a huge field.
Finally, selective events occur all the time. (I'm thinking about the
finches on Galapagos that had beak size changes, but there are lots of cases
in molecular biology.)
So variation and selection are well known, and practiced in the lab all the
time. (I've selected mutants that could not make thymine, for example. The
fact that I did it does not mean it didn't happen or that the same mechanism
doesn't work in nature, we've seen that too.)
> So, to use the terminology of the illustration, the theory of flight
> is there on paper (looking very "possible"), but no one has thus far
> produced a likely engine to make it all work (leaving it, for the time
> being, quite "improbable").
Have you heard of in vitro selections such as SELEX? Have you heard of
genetic algorithms? They work very nicely even from completely scrambled
starting points!
> This is what I meant when I wrote: "I have no reason to believe that
> the former [i.e., the calculations on paper] serves to substantiate
> (or render probable) the latter [i.e., the assumption that what has
> been calculated has actually taken place or does take place], except
> by defining it as thermodynamically 'possible'."
How much math do you know? Do you know any calculus?
> Do you know ...
I've heard of these people.
> Do you know Dr. Royal Truman? His article "The Problem of
> Information" [http://www.trueorigin.org/dawkinfo.htm] seems to
> indicate that he does indeed agree with the statement. He is a
> biochemist.
Yes, I'm familiar with http://www.trueorigin.org/dawkinfo.htm It has lots of
flaws, but you might like to know that he is basically right, his question
has not been properly answered.
> > Notice that this cuts both ways for scientists and creationists.
>
> Whether you wish to accept the fact or not, there are scientists who
> subscribe to the evolutionary paradigm, and there are scientists who
> subscribe to the creationary paradigm (I just cited two examples of
> the latter above, and there are thousands of others). Your
> description of "scientists" as opposed to "creationists" reveals an
> apparent tendancy on your part away from objectivity (at best) or
> towards intellectual bigotry (at worst). If you truly wish to
> continue this dialogue, I invite you to choose your words more
> carefully and refrain from such unreasonable and inflammatory swipes.
I see. I suppose that I don't consider people who subscribe to creationism
to be doing what I call science. When arguing for creationism, they are not
scientists, though they may call themselves that. This is not an attack.
In particular, I have yet to learn a single new fact about the world from a
creationist's experiments. In contrast, I learn new facts about the world
from papers by scientists all the time. When I've had a chance, I have
verified them from myself. (An example from a while ago: I measured the size
of E. coli bacteria, and it came out as people had said, about 1 um by 1 um
by 2 um.) (I can, of course, learn facts that I didn't know before that a
creationist relays to me from a regular scientist.)
I'm a scientist. What are you?
> > > since the law is plainly understood to indicate (as does
> > > empirical observation) that things tend towards disorder,
> >
> > This is incorrect.
> >
> > Not everything tends to disorder. Crystal growth...
>
> I have already answered many citations of "crystal growth" as apparent
> "explanations" for the alleged thermodyanmic feasibility of evolution.
> Rather than repeat myself again, please allow me to refer you to:
>
> http://www.trueorigin.org/steiger.htm
> http://www.trueorigin.org/isakrbtl.htm
> http://www.trueorigin.org/9708.htm
> http://www.trueorigin.org/9801.htm
I thought we were going to stay focused on your paragraph. I've looked at
those pages and they do not answer my questions. (They are full of errors we
could get caught up unearthing, so let's stick to your paragraph.)
> Some content may be repeated among these four documents, but using the
> "find" function of your browser and reading (or re-reading) the
> passages in which the word "crystal" is located, I think you will find
> that the difference between crystal formation and the creation of
> genetic information is not so easily blurred with an experiment in
> which rock candy crystals are made.
One step at a time, can we agree on that?
The first question is
a. What happens to the heat that was in the jar?
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 12
From twallace@trueorigin.org Sun Aug 1 00:21 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id AAA19072 for
Email number 13
From toms Mon Aug 2 00:40:21 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Mon, 2 Aug 1999 00:40:21 -0400 (EDT)
In-Reply-To: <37A3CADE.4E8FEE90@trueorigin.org> from "Timothy Wallace" at Aug 1, 99 00:19:42 am
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 3799
Tim
While I agree about getting to the point, you have ignored all of my
questions in post 11,
(http://www-lecb.ncifcrf.gov/~toms/twallace/index.html#11). I would still
like to know your answers to them.
If you sincerely would like a precise and complete answers to your questions,
then please bear with me and step through the ideas with me. This is subtle
stuff.
| You began by assuming that I did "not understand that the entropy of
| an unisolated system can increase, at the expense of the rest of the
| universe," and asked whether I was "intentionally ignoring" the fact.
|
| I asked you to cite the specific passage(s) from my text which seemed
| to indicate your assumption to be true. Notwithstanding your failure
| to cite such a passage in which such a lack of understanding were
| unambiguously evident, I have explicitly indicated to you, in any
| case, that I do indeed understand that the entropy of an unisolated
| system can increase, at the expense of the rest of the universe.
|
| In short, your question has been answered.
Did you forgot to change the word "increase" to "decrease"? You agreed to
this in: http://www-lecb.ncifcrf.gov/~toms/twallace/index.html#8
Here is the passage from http://www.trueorigin.org/steiger.htm:
| Evolutionist theory faces a problem in the second law, since the law is
| plainly understood to indicate (as does empirical observation) that things
| tend towards disorder, simplicity, randomness, and disorganization, while the
| theory insists that precisely the opposite has been taking place since the
| universe began (assuming it had a beginning).
If you now agree that the Second Law of Thermodynamics allows for (local)
decreases in entropy, then it poses no problem for evolutionary theory. In
that case, this statement is not valid and can be removed from your web page
(or better, kept there but retracted by inserting a statement that you have
changed your mind). On the other hand maybe you mean some other problem, in
which case please explain yourself.
To keep everybody honest, may I have permission to place a copy of the
current version http://www.trueorigin.org/steiger.htm on my web site (with
perhaps minor modification to remove or correct broken links) without change
to the text? I will indicate date and source (URL) at the top.
Please give me a reference in the scientific literature to the "generalized
second law". On the web it seems to appear only in creationist literature,
and it is not well defined.
I can precisely answer your second question about origin of information from
raw random sequence, and will do so after my paper on the topic has been
accepted in a scientific journal. So we may have to wait a while on this,
but I am not evading you on the question. (In the meantime the answer is, of
course, gene duplication, divergence and selection, all of which are
"empirically evident mechanisms/processes". Check out the fantastic genomic
comparisons done by tigr!)
So you want to know precise empirically verified molecular mechanisms? To
make sure that we understand each other precisely, let's get some simple,
experimentally verifiable cases of entropy decrease out of the way and then
proceed to some more difficult but still verifable molecular cases. (I can
even tell you where to order the stuff to do the experiments if you want! I
think you might find it fun.)
Boil some water, and add a lot of sugar to it, until the sugar won't disolve
any more. Pour it into a jar. Set the jar aside. What happens to the heat
in the jar?
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 14
From twallace@trueorigin.org Tue Aug 3 22:22 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id WAA04369 for
Email number 15
From toms Thu Aug 5 00:02:30 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Thu, 5 Aug 1999 00:02:30 -0400 (EDT)
In-Reply-To: <37A7A353.122DC5DE@trueorigin.org> from "Timothy Wallace" at Aug 3, 99 10:20:04 pm
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 2987
Tim:
| 1) For your benefit and for the sake of clarity, below I am re-sending
| my last post, replacing "increase" with "decrease" where we earlier
| agreed that it was warranted.
Other than refomatting one paragraph, the text was not changed.
| 2) Notwithstanding your noble ambition to "keep everybody honest", I
| do not give permission to re-publish any material from the TrueOrigin
| site.
Ok.
| 3) I am not in a position to provide you with references to the
| generalized second law in the scientific literature.
Thanks for the pointer though. I found the 16 you mention are at altivista
("generalized second law") and see that the physicists are apparently talking
about a generalized second law for the physics of black holes:
MINNOWBROOK SYMPOSIUM ON THE STRUCTURE OF SPACE-TIME MAY 28 - 31, 1999
http://www.phy.syr.edu/research/he_theory/minnowbrook/index.html
http://www.phy.syr.edu/research/he_theory/minnowbrook/wald.html
Bekenstein, J.D. (1974) 'Generalized Second Law of Thermodynamics in
Black-Hole Physics', Physical Review D9(12): 3292-3300.
It related to the entropy of a black hole being one quarter of its surface.
This condition is extreme compared to conditions for living organisms and so
does not appear to be relevant to discussions of evolution without a strong,
cogent supporting argument.
| ... while there is no question that gene
| duplication, divergence, and selection are all empirically evident
| mechanisms/processes, this does absolutely nothing to answer the
| second question, which requires mechanisms/processes from zero genetic
| data in raw matter to the present vast array of genetic data.
| (Starting with "gene duplication" begs the question by assuming that
| genes already exist.)
Right. The question of the origin of life is separate from the question of
increase of information once there were genes. But this is off topic.
I'm puzzled by what you mean in the passage from
http://www.trueorigin.org/steiger.htm:
| Evolutionist theory faces a problem in the second law, since the law is
| plainly understood to indicate (as does empirical observation) that things
| tend towards disorder, simplicity, randomness, and disorganization, while the
| theory insists that precisely the opposite has been taking place since the
| universe began (assuming it had a beginning).
Given that we are not talking about the origin of life (where natural
selection and evolution might not apply) and that you agree there can be a
decrease of an unisolated system (though you have yet to put the sentence
together I'll give you the benefit of the doubt for the moment), what is the
problem mentioned in this paragraph?
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
This email is archived at http://www-lecb.ncifcrf.gov/~toms/twallace/
Email number 16
From twallace@trueorigin.org Thu Aug 5 23:22 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id XAA11307 for
Email number 17
From toms Sun Aug 8 20:29:49 1999
To: twallace@trueorigin.org
Subject: Re: TrueOrigin Feedback Response
Content-Length: 6023
Tim:
In http://www.lecb.ncifcrf.gov/~toms/twallace/index.html#14 you said:
| 1) For your benefit and for the sake of clarity, below I am re-sending
| my last post, replacing "increase" with "decrease" where we earlier
| agreed that it was warranted.
Now in http://www.lecb.ncifcrf.gov/~toms/twallace/index.html#16 you said:
| > Other than refomatting one paragraph, the text was not changed.
| Yes, that was my intention, and I believe that is what I indicated.
So, you were going to change one word and didn't. You have come down solidly
on both sides of the issue! :-)
| I am perplexed at how difficult it sometimes seems for intelligent,
| educated men -- scientists, no less -- to research a matter with which
| they, by the very nature of their training and field of expertise,
| might reasonably be expected to have at least some familiarity.
Hm. I'm getting the impression that this is your policy:
when in doubt
insult the lout
| Your comments imply that you are willing to recognize only that the
| generalized second law applies to black hole physics, and nothing else, since
| this as all you've seen with your own eyes (having ostensibly never heard of
| the generalized second law before[?])...
I work in a huge variety of fields and so am always learning. I am not so
rigid as you imply. Until I see a reliable source for something you state I
will have doubts about it. This is because so many things on your web site
are clearly made up or incorrect. So you are starting from a bad position
for me and have to prove yourself to be a careful researcher. So far the
business about the correcting the word does not indicate care, but people can
and do make mistakes. The question is whether they will correct the mistake
and go on with their lives or whether they keep sticking in the mistake.
| At:
| http://www.geocities.com/~combusem/CHEHIST.HTM
| and
| http://www.weburbia.com/pg/hist2.htm
| Rudolf Clausius is credited with formalizing(?) the generalised second
| law of thermodynamics (1850). Unless black holes were being studied
| or postulated at that time, there would seem to be a hint from this
| date that the generalised second law would likely be applicable to
| more than just the physics of black holes.
The relevant entire content of these sites on this issue is:
"1850: Rudolf Clausius generalised second law of thermodynamics."
The Clausius form is dS>= dq/T, which you object to when written as -ds <=
-dq/T! Most people today realize that there are many forms of the Second Law
(see the Jaynes references in:
http://www.lecb.ncifcrf.gov/~toms/twallace/index.html#7) So it is usually
just called the Second Law. The phrase above probably means that Clausius
generalized the law on that date. Now-a-days we don't think of it as any
different than the law itself (it just sounds fancier and more obscure).
The physics pointers are to quantum gravity. I doubt that these are directly
relevant to living things. The economics pointer is also probably not
directly relevant.
| See also:
| http://www.math.toronto.edu/~pivato/latex/dis/dis.html
| (Section 3.2.3 "A Generalised Second Law of Thermodynamics" [and
| following] does not seem to address black holes.)
This is one person's generalization, though I'm not sure it is necessary.
| The above citations, at the very least might help make it plain that
| the generalized second law relates to more than black holes, and that
| it relates the second law's principle of entropy to a wide variety of
| applications (besides just heat entropy, as commonly associated with
| the second law in its classic form).
The citations make it clear that there are probably several different
definitions, most of which are not relevant.
| The problem is that (speaking strictly from a biological standpoint),
| although evolution is claimed to be *the* explanation for such a
| decrease (both with respect to reduced heat entropy and information
| entropy), there exists no empirically supported evidence to
| substantiate such a claim:
| 1) The fact that living organisms are able to convert and store energy
| and put it to work in specific, orderly ways is not ipso facto
| evidence for evolution: it is merely proof that living organisms are
| able to convert and store energy and put it to work in specific,
| orderly ways. Evolution deserves no credit for this in the absence of
| unambiguous compelling evidence that (and how) these processes got the
| way they are through purely natural means.
| 2) The fact that living organisms grow and function in specific,
| orderly ways, in accordance with highly complex and voluminous
| instructions inherent in their genetic information is not ipso facto
| evidence for evolution: it is merely proof that living organisms grow
| and function in specific, orderly ways, in accordance with highly
| complex and voluminous instructions inherent in their genetic
| information. Evolution deserves no credit for this in the absence of
| unambiguous compelling evidence that (and how) this information became
| so highly complex and voluminous through purely natural means.
Evolution is the result of replication, genetic variation and selection in a
population of organisms. So evolution (as the end product) is not the
explanation of the decrease you are worried about. However, selection does
the trick. There are plenty of examples of this, including breeding of
animals and plants and selections in the lab of biological systems. Read
Origin of Species to see the huge amount of evidence even 1.5 centuries ago.
We've come quite a way since then.
So "evolution" does not have a problem with the Second Law. You apparently
have a problem seeing how the Second Law fits quite nicely with evolutionary
processes.
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 18
From twallace@trueorigin.org Sun Aug 8 22:50 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id WAA19541 for
Email number 19
From toms Wed Aug 25 01:02:42 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Wed, 25 Aug 1999 01:02:42 -0400 (EDT)
In-Reply-To: <37AE4158.D7F87811@trueorigin.org> from "Timothy Wallace" at Aug 8, 99 10:47:52 pm
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 7953
Tim:
| My apologies for the mistake (again). If you like, I will again
| re-send the post, after making absolutely certain that 'increase' has
| in fact been changed to 'decrease'.
Just the one paragraph will do.
|> The Clausius form is dS>= dq/T, which you object to when
|> written as -ds <= -dq/T!
|
| On exactly what specific basis do you claim that I "object" to the
| form written above?
It was the paragraph correction. Besides, you have been remarkably careful
to ask questions rather than make solid statements.
Ok, we've beaten "G2L" into the ground. Looks to me like it's just another
form or various specializations of the Second Law. Renaming it is not going
to change it.
| > Evolution is the result of replication, genetic variation and
| > selection in a population of organisms...
| You've just described 'MICRO-evolution', which is essentially the same
| thing as genetic variation itself.
Well, lots of people say that molecular clocks are "evolution" but I just
think of that as drift. Sometimes it might get somewhere interesting, but
most of the time it probably doesn't. That is, all of the cytochrome C's are
doing the same thing and the variations don't have much effect.
Further, there is no precise distinction between micro and macro evolution.
But I think that there is a big difference between variation (which includes
dead variants or ones that don't reproduce) and small steps of evolution
(micro).
What prevents micro evolution from being macro evolution over the course of 3
million years?
| In effect you've presented a
| tautology by saying genetic variation is the result of genetic
| variation (or [micro-]evolution is the result of [micro-]evolution).
| Talking in circles like this does nothing to explain the alleged
| 'evolution' of NEW genetic data, specifying NEW physiological traits
| or organs, or the emergence of NEW and varied biological energy
| conversion, transport, and storage mechanisms. A passing reference to
| '(micro-)evolution' simply does not explain these things.
Sure, by your definition of micro-evolution. But when does when does micro
end and macro start?
| > However, selection does the trick...
|
| No, it does not. Selection is only able to select from what is
| already present in the genetic potential of the subject population.
| Selection has not been shown empirically to generate unequivocally new
| or more complex genetic information or unequivocally new physiological
| traits or organs. It merely selects from the genetic potential for
| variation already inherent in the population's combined genetic
| potential (the 'gene pool').
No, selection also plays on the mutations, which keep increasing the
variation.
There is no such thing as "genetic potential", just as there is no limit to
the number of sentences.
It is also wrong to think that selection can't produce unequivocally new
functions, as that has been demonstrated many times by things like SELELX.
| It is a logical fallacy (i.e., begging the question) to assume that
| the 'gene pool' already contains unequivocally new or more complex
| genetic information or unequivocally new physiological traits or
| organs, when the genetic potential can more easily be (and has been
| empirically shown to be) comprised of a combination of already
| existing traits (some dominant, some recessive) in the subject
| population's 'gene pool' -- traits which are subsequently manifested
| in succeeding generations (sometimes dominant, sometimes recessive)
| according to the indications of the genetic code as the population
| reproduces.
The pool doesn't contain the new or "more complex" information at first. It
appears in variants. The DNA polymerase makes mistakes when it copies and
there are lots of rearrangements by transposons. Mendel isn't everything.
| > There are plenty of examples of this, including breeding of
| > animals and plants and selections in the lab of biological
| > systems.
|
| These, again, are examples of genetic variation (animal and plant
| breeding is selection for specific, already existing traits or
| combinations of already existing traits, and laboratory selection of
| biological systems likewise selects that which already exists).
No, when people do chemostat experiments on bacteria (to pick an example) the
first thing that one should do is streak out the bacteria twice to get a pure
genetic strain. Then this is frozen down as a record of the start point.
All further variation comes from that one strain. So in any decent
experiment (ie, publishable) there is NO variation initially.
| They
| must not be confused with the allegation made by evolution proponents
People who look at the data recognize that it is the simplest explanation
available for a vast amount of data.
| that natural processes can account for new and more complex genetic
| data, new and more complex organs and traits, and new and more complex
| energy conversion, transport, and storage mechanisms. Genetic
| variation (or [micro-]evolution) has not been shown empirically to be
| capable of generating these things.
See above about SELEX.
| > So "evolution" does not have a problem with the Second Law.
| It has not been empirically and unequivocally demonstrated that known
| natural processes can account for the generation of new and more
| complex genetic data, new and more complex organs and traits, and new
| and more complex energy conversion, transport, and storage
| mechanisms. Specific natural processes to which can be attributed the
| entropy decreases necessarily associated with the generation of these
| things have similarly not been empirically and unequivocally
| demonstrated.
That's very different from having a problem with the Second Law!!
| This being the case, yes, evolution DOES have a problem with the
| Second Law -- not in the popularly misunderstood sense that entropy
| decreases are impossible, or even commonplace, but in the sense that a
| technical possibility is not ipso facto proof (or even evidence) that
| the specific alleged entropy decreases cited above, and their
| associated alleged natural mechanisms and processes, are therefore
| given as scientifically probable or even possible.
You vaguely imply that SELEX doesn't work!
| > You apparently have a problem seeing how the Second Law fits
| > quite nicely with evolutionary processes.
| Yes, I do(!). You, on the other hand, seem to have a problem
| differentiating between (micro-)evolution (i.e., natural selection in
| combination with genetic variation -- an empirically observed and
| understood phenomenon) and (macro)evolution (i.e., an empirically
| unsubstantiated extrapolation of (micro-)evolution).
Yes, it is not at all clear to me where one ends and the other begins. Many
tiny changes over millions of years could mold the organism enormously. This
is often, granted, an extrapolation. In some cases (horses) it is a 'connect
the dots'. There isn't a better explanation around.
| You also seem to
| have a problem differentiating between a general, calculable change in
| entropy and a real-world, empirical demonstration of a specific
| process and its inherent mechanism(s) for effecting such a change in
| entropy -- that specific process being (in this case) the generation
| of new and more complex genetic data, new and more complex organs and
| traits, and new and more complex energy conversion, transport, and
| storage mechanisms.
I see what you are asking for. The question is: what kind of data would
satisfy you, besides time travel?
If I measure the two short legs of a right triangle, can I figure out the
length of the long side without measuring it?
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 20
From twallace@trueorigin.org Sat Aug 28 11:35 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id LAA01107 for
Email number 21
From toms Thu Sep 2 16:34:09 1999
To: twallace@trueorigin.org
Subject: Corrections Requested
Bcc: hoppnrmt@digisys.net
Content-Length: 1513
Dear Tim Wallace:
You agreed on July 27, 1999 (http://www.lecb.ncifcrf.gov/~toms/twallace/6) to
abide by the terms I proposed on July 23, 1999
(http://www.lecb.ncifcrf.gov/~toms/twallace/3). The agreement was:
| I will agree to your posting our discussion under the following conditions:
|
| 1. My complete messages are to be posted, without any modifications.
|
| 2. You may in addition quote portions of the message, but they must be in
| proper context. If in any doubt, use complete sentences and no ellipsis.
|
| 3. I am allowed to post your messages on my web site. I may point to your
| complete message but I may also quote portions in proper context.
I see now at your web site (http://www.trueorigin.org/9907.htm) that you have
posted my first message but you have not included the URL at the end of my
signature block.
Please immediately correct this oversight.
I also note that although the apostrophe (') appears on that page, it is
lacking from the word "don't" in one of my sentences, "I suppose that I don't
consider people who subscribe to creationism to be doing what I call
science." Please correct this and other spelling oversights. My original
message had the apostrophe (http://www.lecb.ncifcrf.gov/~toms/twallace/11).
Sincerely yours,
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 22
From twallace@trueorigin.org Thu Sep 2 21:48 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id VAA20568 for
Email number 23
From toms Mon Sep 6 23:08:50 1999
Subject: Re: Corrections Requested
To: twallace@trueorigin.org (Timothy Wallace)
Date: Mon, 6 Sep 1999 23:08:50 -0400 (EDT)
In-Reply-To: <37C80128.1C70F7E0@trueorigin.org> from "Timothy Wallace" at Aug 28, 99 11:32:56 am
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 355
Tim:
Thank you for correcting your web site.
Would you mind making the link to my URL active please?
Thanks,
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 24
From toms Mon Sep 6 23:13:13 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Mon, 6 Sep 1999 23:13:13 -0400 (EDT)
In-Reply-To: <37C80128.1C70F7E0@trueorigin.org> from "Timothy Wallace" at Aug 28, 99 11:32:56 am
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 30750
Tim:
| So then do you retract your assertion that I "object" to dS>= dq/T
| when written as -ds <= -dq/T? Do you now retract your assertion
| (repeated multiple times) that I do not understand that the entropy of
| an unisolated system can decrease, at the expense of its
| surroundings? Or are you blithely skipping along to other topics, as
| if bearing false witness is a perfectly acceptable practice, requiring
| no retractions or apologies on the part of the perpetrator?
Please be polite.
No need to get all upset. Just make clear statements of what you are
thinking and we can discuss them. If you want to do verbal attacks (which
the above feels like to me) then we can just terminate this discussion.
Otherwise we may both have somethings to learn from each other.
This was one of the clearer, although still indirect, statements that you
have made. Previous statements were not made when you said you would, then
you made the wrong statement. It has been like extracting teeth to get a
clear statement from you. If you insist on making indirect statements, then
you will inevitably be misunderstood.
Though you now indirectly imply that you agree that -ds <= -dq/T is valid, my
understanding is that you think it rarely happens. You have avoided
answering my previous questions along those lines. In particular, you have
not answered my question about a simple jar of water
(http://www.lecb.ncifcrf.gov/~toms/twallace/#9 [corrected from #5]).
Are you willing to make a clear positive statement about the Second Law?
| I have no choice but to ask questions if I want you to substantiate
| your statements. I suppose I could respond in the form of an
| accusation, but I suspect that would be counterproductive.
The above was rather full of accusations. "blithely skipping along",
"bearing false witness", "the perpetrator". I surmise that either this is an
intentional tactic to throw me off, which you have used with other people, or
you are very scared and angry. If so, what are you scared of? What would
happen if you were wrong?
Your nasty words seem inconsistent to me since I thought you were coming from
a philosophy that teaches that god is love, and that one should love ones
fellows. Was I wrong?
| > Ok, we've beaten "G2L" into the ground. Looks to me like it's
| > just another form or various specializations of the Second Law.
|
| Thank you for finally acknowledging the simple fact.
Ok, then let's just call it the Second Law, and drop "G2L", which sounds
fancy but no special meaning. May I suggest you simplify and clarify issues
by saying "The Second Law of Thermodynamics" on your web site?
As for the various forms, Jaynes' lovely paper is really a neat to read!
http://www.lecb.ncifcrf.gov/~toms/glossary.html#Second_Law_of_Thermodynamics
| > ...there is no precise distinction between micro and macro
| > evolution.
|
| That's not true. There is a very significant distinction.
| "Micro-evolution", by definition, is the same thing as genetic
| variation (the shuffling of existing genetic information).
No, variation is not evolution. Biological evolution also requires
selection.
| It is both
| observable and observed, measurable and measured, repeatable and
| repeated -- in short, it has been scientifically verified as a natural
| phenomenon. However, in every single case, the organism that has
| undergone the variation is the same kind of organism.
What do you mean by "the same kind"?
Here are two sequences:
Query: 5 tggattttggcgtaggtttggtctagggtgtagcctgagaataggggaaatcagtgaatg 64
||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 6558 tggattttggcataggtttggtctagggtatagcctgagaatagggggaatcagtgaatg 6499
Query: 65 aagcctcctatgatggcaaatacagctcctattgataggacatagtggaagtgggctaca 124
||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||
Sbjct: 6498 aagcctcctatgatggcgaatacagctcctattgatagaacgtagtggaagtgggctacg 6439
Query: 125 acgtagtacgtgtcgtgtagtacgatgtctagtgatgagtttgctaatacaatgccagtc 184
|||||||| ||||||||||| |||||||||| |||||||||||||| ||||||||| ||
Sbjct: 6438 acgtagtatgtgtcgtgtagcacgatgtctaatgatgagtttgctagtacaatgccggtt 6379
Query: 185 aggccacctacggtgaaaagaaagatgaatcctagggctcagagcactgcagcagatcat 244
||||||||||||||||| |||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 6378 aggccacctacggtgaagagaaagataaaccctagggctcagagtactgcggcagatcat 6319
Query: 245 ttcatattgcttccgtggagtgtggcgagtcagctaaatactttgacgccggtggggata 304
||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| || |||
Sbjct: 6318 ttcatattgcttccgtgaagtgtagcgagtcagctgaatactttgacgccggtaggaata 6259
Query: 305 gcgatgattatggtagcggaggtgaaatatgctcgtgtgtctacgtctattcctactgta 364
|| |||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 6258 gcaatgattatggtagcggaggtgaaataggctcgggtgtctacgtctatccctactgta 6199
Query: 365 aatatatggtgtgctcacacgataaaccctaggaagccaattgatatcatagctcagacc 424
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 6198 aatatatggtgtgctcacacgataaaccctaggaagccaattgatattatagctcaaacc 6139
Query: 425 atacctatgtatccaaatggttcnnnnnnnccggagtagtaagttacaatatgggagatt 484
|| ||||| |||||||||||||| |||||||| ||||||||||| ||||| |||
Sbjct: 6138 atgcctatatatccaaatggttctttttttccggagtaataagttacaatgtgggaaatt 6079
Query: 485 attccgaagcctggtaggataagaatataaactttcaggtgaccgaaaaatcagaaatag 544
|||||||||||||||||||||||||||||||||| |||| || ||||||||| ||||
Sbjct: 6078 attccgaagcctggtaggataagaatataaacttcggggtggccaaaaaatcag-aataa 6020
Query: 545 gtgtgggtatagaat-gggtctccttctncggcggggtcgaagaa 588
|||| | |||||||| ||||||||| | |||| |||||||||||
Sbjct: 6019 gtgttgatatagaatagggtctcctcccccggctgggtcgaagaa 5975
They are the same at 530 out of 585 bases (90%) with two gaps. Are they the
same kind? How can I tell? By "how", I mean by what precise procedure or
algorithm that I could program into a computer please. If you want to say
something like "90% means they are of the same kind, then on what basis do
you pick 90%? That is, I'm looking for an algorithm that does not have
arbitrary constants.
| The distinction is both precise and significant. To blur the
| distinction is to show contempt for empirical science and mix fact
| with fancy.
Please stop being nasty.
If it is so precise, please apply it to the above two sequences to answer
whether they are the same kind or not.
| Frankly, you are engaging in semantic subterfuge.
Again, please keep the nasty implications out of this discussion.
| "In the meantime, the educated public continues to believe
| that Darwin has provided all the relevant answers by the
| magic formula of random mutation plus natural selection --
| quite unaware of the fact that random mutations turned out
| to be irrelevant and natural selection a tautology."
| [Koestler, Arthur, Janus: A Summing Up (New York: Vintage
| Books, 1978) p. 185]
Random mutations irrelevant? How is it that there is such a diversity of
people if we came from only two people? (Is that what you believe?)
| "It has been estimated that those chance errors occur at a
| rate of about one per several hundred million cells in each
| generation. This frequency does not seem to be sufficient
| to explain the evolution of the great diversity of life
| forms, given the well-known fact that most mutations are
| harmful and only very few result in useful variations."
| [Capra, Fritjof, The Web of Life (New York: Anchor Books,
| 1996) p. 228]
Oops. He must have made mistakes. Aside from the fact that he may have
forgotten that somatic cells are not germ cells (it depends on the context)
there are lots of progeny and there are populations of animals. There is
lots of variation as a result. (The mutation rate in HIV is one per genome
per generation! Typical numbers are 1 in 10^6 per gene locus, which is quite
sufficient to do all kinds of fancy selections on bacteria in the lab since
one can easily have 10^8 bacteria per mil. Of course it can go WAY up when a
transposon is active, or maybe even under stress conditions.) Rock layerings
(the grand canyon!!) and radioactive decay rates and other evidence indicate
that there was also a lot of time available.
| "It should be clear that the claim for an inherent
| evolutionary increase in entropy and organization is based
Oops! This person didn't understand that entropy decreases correspond to
"organization". They got it backwards.
| on an arbitrary model which shows signs of having been
| constructed simply to yield the desired result. There is
| nothing in evolutionary or developmental biology that
| justifies their assumptions that a successful mutation
| (which seems merely to mean a selectively neutral one in
| their model)
Well that seems silly, but it is clearly taken out of context Tim!
| is always associated with an increase in some
| global measure of phenotype.
Ok, good, it will be worth publishing on this.
| Nor is there anything to
| support the assumption that new species arise as the result
| of single gene mutations and are initially genetically
| uniform. If these assumptions are removed, the whole edifice
| collapses."
Generally it is not thought that a single mutation could cause speciation; it
is probably a cluster of them.
| [Charlesworth, Brian, "Entropy: The Great Illusion," review
| of Evolution as Entropy by Daniel R. Brooks and E. O. Wiley
| (Chicago: University of Chicago Press, 1986, 335 pp.),
| Evolution, vol. 40, no. 4 (1986) p. 880]
Oh yea. Brooks and Wiley. They confused digital noise with evolution! In
other words, they didn't know what they were doing. Are they creationists?
How surprising! (Or did you taking them out of context Tim?)
| "The fruit fly has long been the favorite object of mutation
| experiments because of its fast gestation period (twelve days).
| X rays have been used to increase the mutation rate in the
| fruit fly by 15,000 percent. All in all, scientists have been
| able to 'catalyze the fruit fly evolutionary process such that
| what has been seen to occur in (fruit fly) is the equivalent
| of many millions of years of normal mutations and evolution.'
| Even with this tremendous speedup of mutations, scientists
| have never been able to come up with anything other than
| another fruit fly."
| [Rifkin, Jeremy, Algeny (New York: Viking Press, 1983) p. 134]
With legs coming out of its head? With FOUR wings? Four wings would be
considered another species, like a dragon fly! How about eyes all over its
body? :-) Rifkin should do some more reading, he chose a bad example!
Why would it be so easy to get 4 wings? Because the back two were repressed
into the halter during evolution. The ancestor was multi segmented; later
genes repressed things in different segments. It's rather lovely genetic
work, and a beautiful system. Worth reading about, Tim. You have
segmentation and homeo box genes too.
| "The proof of the occurrence of mutations is by no means a
| proof of a current evolution. The most important the
| inescapable question, is whether the mutations are fully vital,
| so that they are able to survive in natural stands. A review of
| known facts about their ability to survive has led to no other
| conclusion than that they are always constitutionally weaker
| than their parent form or species, and in a population with
| free competition they are eliminated."
| [Nillson, Heribert, (Lund, Sweden: Verlag CWK Gleerup, 1953),
| (English summary) p. 1186]
So how does one account for the new strains of influenza that pop up every
fall? What about the changes in HIV during infection?
Golly that's an old reference.
| > There is no such thing as "genetic potential", just as there is
| > no limit to the number of sentences.
|
| Indeed just as there are distinct limits to what constitutes a
| meaningful sentence, there are also distinct limits to viable genetic
| arrangements. Meaningful sentences aren't random mixtures of words,
| letters, and spaces, and nor has genetic code ever been shown to be a
| random mixture of unordered genetic material. Genetic variation is
| not a mix-n-match free-for-all.
Oh of course not. Even with the demand for a functional system, the sequence
space is still vast! Life on earth could not have possibly explored even a
tiny fraction of the possibilities. The size of the sequence space does not
prevent organisms from evolving.
| By "genetic potential" I simply mean the range of genetic variations
| inherent in the subject population. The population's gene pool
| contains a finite set of genetically determined features.
Well I have to agree it is finite. But what does that mean in this context?
E. coli is 4639221 base pairs long. So the (finite) number of (DNA based!)
organisms this size is 4^4639221 = 10^2793089 = 1 followed by 2.7 million
zeros, which is horrifically big. Most probably won't work. Given the
variants of E. coli that are known, perhaps 70% of these would be
functional. (How did I compute that? You'll have to read my papers.)
But if we streak purify a bacterium (do you know any basic biology?), there
is only one to start with. There is initially no variation. Yet I can get
sequence variants. So 'genetic potential' must be bigger than just the
existing variants. What would limit where the changes occur? Certainly the
DNA polymerase can't do that, it doesn't have enough brains.
So there is no "genetic potential", no limit on an organism on where it can
get to from where it currently is.
If you still don't understand that, go and streak purify some bacteria
several times and then *select* some mutants.
| The
| "genetic potential" of that population (while surely unknown, due
| largely to limits in the scope of man's knowledge) consists of the
| entire set.
It's a subset, as discussed above.
| That limited set does indeed exist, just as the number of
| potential sentences also has a limit, since the number of words,
| meanings, and combinations, while so vast as to be unknown (if not
| incomprehensible) to man, is nevertheless finite.
It is big but not incomprehensible. People play with much bigger finite
numbers. Though finite, it is so large that it does not restrict. Your
concept of limited "genetic potential" is full of holes. That's why modern
molecular biologists don't use it.
| > It is also wrong to think that selection can't produce
| > unequivocally new functions, as that has been demonstrated
| > many times by things like SELELX.
|
| It isn't clear what you mean by introducing the term "functions", but
| I invite you to cite a basis for thinking that selection, in and of
| itself, can yield an increase in quantity and quality of genetic
| information and -- therefore -- any unequivocally new genetic traits.
Read the SELEX literature and read the literature in the next few years.
But for now, a new function can be for a molecule to stick to another
specifically or for a molecule to do some enzymatic reaction. These have
been done starting with random sequences by SELEX and other techniques.
| I also invite you to cite a basis for believing that SELEX produces an
| increase in quantity and quality of genetic information and --
| therefore -- unequivocally new genetic traits.
Oh that's easy, read any SELEX paper. Compute the information content of the
binding sites.
| > The pool doesn't contain the new or "more complex" information
| > at first. It appears in variants.
|
| This seems like more semantic subterfuge.
Please keep the nasty implications out of the discussion, it implies to me
that you are unable to respond rationally and so chose to attack me instead
as a distraction. This is not an attack, it is an observation about what you
are doing.
| Let's keep our terminology
| clear: Variation is limited to the manifestation of variables
| inherent in the genetic code. Mutation is limited to (degenerative)
| changes to the genetic information itself.
There is no reason to suppose that mutation (or more precisely, sequence
changes) are always degenerative. The SELEX experiments show clearly that
there is no such limitation.
There is a problem with the terminology. When we say 'mutation' we usually
imply a bad thing for the organism. But that is our term. I work with lots
of people who are sequencing human genes. They find a change in the gene and
would like to know if it is a polymorphism or a mutation. We do a splice
junction analysis and can often make clear statements about what's going on.
Other times we can't. In either case more experimental would could be done
to determine what the effect is. So we have to be very careful with our
language. That whole project started because someone mistakenly stated that
a certain T->C change caused a colon cancer. Our analysis said it was
unlikely. Later someone else sequenced 20 normal people and 2 of them had
this change. So it was a polymorphism. Language can fool you.
Early this year on Burt Vogelstein, who did the 2/20 experiment told me that
some company had sunk over a million dollars into an assay for this
polymorphism! What a waste of money!
(The reference is
http://www.lecb.ncifcrf.gov/~toms/paper/colonsplice/index.html)
| While it is a popular
| practice to treat these two as synonymous, they are not: one is an
| empirically established natural phenomenon in healthy populations, the
| other is an empirically established source of disease and defect, the
| effects of which are largely weeded out by selection (a process for
| which we should be thankful!).
Well, though the mutation was interesting, I rather am sorry that the little
9 year old boy whose DNA sequence we analyzed has Xeroderma Pigmentosum.
It's sad to see him suffer. It was sobering, last January, to finally see
the faces of the people whose DNA I had helped analyze.
I am not thankful for this, aside from my observation that there is evidently
no one to "thank" for it other than an errant DNA polymerase molecule and a
bit of thermal noise or a photon.
(The reference is S. G. Kahn, H. L. Levy, R. Legerski, E. Quackenbush, J. T.
Reardon, S. Emmert, A. Sancar, L. Li, T. D. Schneider, J. E. Cleaver, and K.
H. Kraemer. Xeroderma Pigmentosum Group C splice mutation associated with
mutism and hypoglycinemia - A new syndrome? Journal of Investigative
Dermatology, 111:791-796, 1998.)
But how are we to think of mutations in the hemoglobin gene that cause sickle
cell anemia but *also* protect the heterozygote against malaria? Is it a
"bad" mutation or beneficial one?
| > The DNA polymerase makes mistakes when it copies and
| > there are lots of rearrangements by transposons...
|
| This has a corruptive, degenerative effect on the genetic code.
Only most of the time! But let's be really clear that the function of
transposons is *to mess up the genome*! On occasion a really good mess up is
advantageous. That's why we still have transposons, because they give us the
ability to evolve. (No engineer would intentionally put transposons into a
computer, now would they?)
So there you go. Along with the problem of pain, you now have the problem of
transposons to deal with.
| Errors do not create new information; they damage existing
| information. There is no empirical basis for postulating new or more
| complex information from a process that degenerates existing
| information.
See above about SELEX.
Oh it's easy. Suppose I put contact glue on the tail side of 1000 coins.
Then I flip them by jostling the box and let them glue down. Then I repeat
the process. Roughly how long will it take before all of them are heads up?
(Assume that the coins are spread out and don't glue to each other.) How
about with 4.7 million coins?
| > > These, again, are examples of genetic variation (animal
| > > and plant breeding is selection for specific, already
| > > existing traits or combinations of already existing
| > > traits, and laboratory selection of biological systems
| > > likewise selects that which already exists).
| >
| > No, when people do chemostat experiments on bacteria (to pick
| > an example) the first thing that one should do is streak out
| > the bacteria twice to get a pure genetic strain. Then this
| > is frozen down as a record of the start point. All further
| > variation comes from that one strain. So in any decent
| > experiment (ie, publishable) there is NO variation initially.
|
| Any subsequent changes in such a strain of bacteria will still result
| only from either inherent genetic variables or mutations. If a
| specific trait has been effectively bred out of the strain by
| artificial selection, it will not re-appear unless re-introduced
| through exogenic contamination of the strain or through mutation. In
| either case, no increase in the quantity or quality of available
| genetic information has been effected.
Right. Read the literature in the next few years.
| > > > So "evolution" does not have a problem with the Second Law.
| > > It has not been empirically and unequivocally demonstrated
| > > that known natural processes can account for the generation
| > > of new and more complex genetic data, new and more complex
| > > organs and traits, and new and more complex energy conversion,
| > > transport, and storage mechanisms. Specific natural processes
| > > to which can be attributed the entropy decreases necessarily
| > > associated with the generation of these things have similarly
| > > not been empirically and unequivocally demonstrated.
| >
| > That's very different from having a problem with the Second Law!!
|
| On the contrary, that IS the problem evolution has with the Second
| Law...
Hunh? The Second Law allows for decreases in entropy (see start of this
email and your previous one). So there is no problem. If you still think
this, show me how precisely in the equations.
Just because the Second Law doesn't (alone) explain the information gain does
not mean that there is no information gain.
| "One problem biologists have faced is the apparent
| contradiction by evolution of the second law of
| thermodynamics. Systems should decay through time,
| giving less, not more, order..."
| [Lewin, Roger, "A Downward Slope to Greater Diversity,"
| Science, vol. 217 (September 24, 1982) p. 1239]
Why did you quote this? By doing so are your now saying that you agree with
this statement? Do you have a specific position on this or are you going to
change it all the time?
So to respond specifically to this quote: Nope. In the previous email you
(only!) apparently agreed that -ds <= -dq/T. This is the same as saying that
an increase of information does not violate the Second Law since -ds <= -dq/T
is equivalent to KTln(2) <= -q/R. So if heat leaves a system (ie -q) then
the information change of the system (R) can be positive. See my second
molecular machine paper: http://www-lecb.ncifcrf.gov/~toms/paper/edmm/
| "The greatest puzzle is where all the order in the
| universe came from originally. How did the cosmos
| get wound up, if the second law of thermodynamics
| predicts asymmetric unwinding towards disorder?"
| [Davies, Paul C., "Universe in Reverse: Can Time
| Run Backwards?" Second Look (London: King’s College,
| September 1979) p. 27]
Spreading out cools things down. Total disorder is "hidden" in heat. There
is no puzzle.
Again, you have indirectly (only!) accepted that such decreases DO NOT
VIOLATE THE SECOND LAW. So why do you quote this here? Was it a mistaken
oversight?
| "We are faced with the idea that genesis was a
| statistically unlikely event.
Based on one case? We can't speak very clearly about statistics in such a
circumstance.
| We are also faced with
| the certainty that it occurred. Was there a temporary
| repeal of the second law that permitted a 'fortuitous
| concourse of atoms'?
It is unnecessary to postulate this. The Second Law just means the spreading
out of heat; it can't be 'repealed'.
| If so, study of the Repealer and
| genesis is a subject properly left to theologians. Or
| we may hold with the more traditional scientific attitude
| that the origin of life is beclouded merely because we
| don't know enough about the composition of the atmosphere
| and other conditions on the earth many eons ago."
| [Angrist, Stanley W., and Loren G. Hepler, Order and Chaos
| (New York: Basic Books, Inc., 1967) p. 205]
That's a simple enough hypothesis. Let the facts come forth.
| > You vaguely imply that SELEX doesn't work!
|
| You vaguely imply that SELEX generates previously non-existent genetic
| information.
I suppose you'll have to go read the papers! Maybe you should do some work
in a laboratory and try it yourself instead of this arm chair stuff.
| > Many tiny changes over millions of years could mold the
| > organism enormously. This is often, granted, an
| > extrapolation.
|
| "Could"? On what empirical basis? It is ONLY an extrapolation, and
| it has NO empirical support.
Oh only the observation of the huge variety of organisms. Only the
observation of DNA sequence variations. Only the fossil record layered in a
way that no flood could have produced. Only computer simulations,
mathematical models and theory ... lots of geology too.
The nice thing about all these observations is you don't have to believe
anybody about them, you can go check for yourself.
When you yell that there is no empirical support, you make it appear that you
haven't ever looked closely at a road cut. There is one near you at Sidling
Hill, MD.
http://www.berkeleysprings.com/ecotourism.htm
Sidling Hill Mountain and Visitor Center -- The U.S. interstate highway
system blasted a cut through the mountain in order to make way for Interstate
68. This cut reveals a cross-section of a geosyncline-concave layers of
sedimentary rock at various layers of the earth's crust. Interpretive
exhibits are available free at the visitors center. Approximately 15 miles
west of Berkeley Springs on I-68.
A picture:
http://www.geocities.com/Yosemite/Geyser/2368/dayone2.html
| > ...There isn't a better explanation around.
|
| That's strictly a matter of opinion. And even in the absence of a
| "better explanation", a scientifically unsubstantiated explanation
| should be neither touted as fact, nor assumed to be true.
You know a better, simpler explanation that fits the facts and does not lead
to infinite regress? "God" is not an answer because: 1. it is much more
complex, 2. it doesn't fit the observable facts; 3. it gives infinite
regress. Also, historically it has failed as a predictive hypothesis. One
I've been thinking about recently is the question of why people still don't
insist on saying that god throws lightning bolts down from the sky. This was
a clear hypothesis - Zeus did the throwing. Why isn't that idea still held
by most people?
| > I see what you are asking for. The question is: what kind
| > of data would satisfy you, besides time travel?
|
| The same kind of data that should be required by any self-respecting
| scientist:
Please watch your language. You imply, without knowing me, that I have no
self respect. Whether or not it is true, please strip such implications from
your messages.
While it is true I am a scientist, you denigrate this on your web site by
putting quotes around it. A loving person would not do this. Please remove
them.
You have yet to answer my question (July 30, 1999,
http://www.lecb.ncifcrf.gov/~toms/twallace/#11) as to what you are.
| nothing less than that which would satisfy the requirements
| of empirical science.
That's not said anything so far, and science is broader than just
measurements.
You keep pounding on "empirical science". What about theoretical science?
| That is, data that demonstrate unequivocally
| that natural processes alone can increase the quantity and quality of
| available genetic information.
You take a rather limited view of how science works. Scientists do more than
just make measurements.
How should we measure genetic information? Will Shannon's information theory
do? It's lasted 50 years and has allowed us to build a world wide
communications system. Is that good enough?
What do you mean by "quality"? Will quantity alone satisfy you?
| > If I measure the two short legs of a right triangle, can I
| > figure out the length of the long side without measuring it?
|
| Yes. Why? Not because of mere extrapolation, but because you know
| the unchanging laws of mathematics (not unlike the laws of
| thermodynamics) yield consistent results. The unknown data is
| calculated from the known data and is determined precisely and
| absolutely through a precise and absolute process.
No, the answer - to my surprise!! this was not a trick question! - is that
one *can't* predict the long side! One has to make a postulate about the
number of lines through a point not on a line that are parallel with the
line.
In other words, one has to define the space, and it may be noneuclidian.
This discussion point will have to wait for my publication.
| This is a far cry
| from assuming the existence of an unknown natural process for which
| there is no empirical evidence -- based solely on an empirically known
| natural process, the similarity of which begins and ends with the fact
| that their names share the same root word!
There a ton of evidence, and more coming in all the time you just somehow
ignore it. Why do you ignore the evidence (eg, those diagonal layers on
Sidling Hill)? The question is how can we explain the tons of empirical
evidence that we already have at hand?
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 25
From toms Mon Sep 6 23:24:15 1999
Subject: pointer correction
To: twallace@trueorigin.org (Timothy Wallace)
Date: Mon, 6 Sep 1999 23:24:15 -0400 (EDT)
In-Reply-To: <37C80128.1C70F7E0@trueorigin.org> from "Timothy Wallace" at Aug 28, 99 11:32:56 am
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 377
Tim:
The pointer for the jar should be:
http://www.lecb.ncifcrf.gov/~toms/twallace/#9
not #5. I have corrected this on my web site.
Tom
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
Email number 26
From twallace@trueorigin.org Tue Sep 7 08:25 EDT 1999
Received: from mail.ncifcrf.gov (mail.ncifcrf.gov [129.43.100.100]) by ncisun1-nf0.ncifcrf.gov (8.8.7/8.7.3) with ESMTP id IAA16138 for
Email number 27
From toms Tue Sep 7 12:43:07 1999
Subject: Re: TrueOrigin Feedback Response
To: twallace@trueorigin.org (Timothy Wallace)
Date: Tue, 7 Sep 1999 12:43:07 -0400 (EDT)
In-Reply-To: <37D503D4.671B73FC@trueorigin.org> from "Timothy Wallace" at Sep 7, 99 08:23:48 am
X-Mailer: ELM [version 2.4 PL24]
MIME-Version: 1.0
Content-Type: text/plain; charset=US-ASCII
Content-Transfer-Encoding: 7bit
Content-Length: 1884
Dear Mr. Wallace:
Thank you for clarifying your personal situation.
| > Are you willing to make a clear positive statement about the
| > Second Law?
|
| I have already stated unequivocally that my understanding is that the
| entropy of an unisolated system can decrease, at the expense of it[s]
| surroundings. That this phenomenon routinely takes place as an
| integral part of observable biological processes is also quite
| apparent.
Good, thank you for making this clear statement.
(I have made a minor correction to the English for you.)
QUESTION 1. Given this, why did you quote the following:
| "One problem biologists have faced is the apparent
| contradiction by evolution of the second law of
| thermodynamics. Systems should decay through time,
| giving less, not more, order..."
| [Lewin, Roger, "A Downward Slope to Greater Diversity,"
| Science, vol. 217 (September 24, 1982) p. 1239
(1999 Aug 28, http://www.lecb.ncifcrf.gov/~toms/twallace/20)
Please explain what the problem is given your statement above.
QUESTION 2. In my last message I said:
| Here are two sequences:
|
| Query: 5 tggattttggcgtaggtttggtctagggtgtagcctgagaataggggaaatcagtgaatg 64
| ||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||
| Sbjct: 6558 tggattttggcataggtttggtctagggtatagcctgagaatagggggaatcagtgaatg 6499
(etc)
I am still very curious what you mean by "the same kind"?
Are these sequences the same kind or not, and by what precise algorithm
can I determine this?
Dr. Thomas D. Schneider
National Cancer Institute
Laboratory of Experimental and Computational Biology
Frederick, Maryland 21702-1201
toms@ncifcrf.gov
permanent email: toms@alum.mit.edu
http://www.lecb.ncifcrf.gov/~toms/
"May your cells remain unoxidized,
may your DNA remain undamaged
and may your telomeres never shorten."
--- a molecular blessing
Tom Schneider's Home Page