merge program

• By downloading this code you agree to the Source Code Use License (PDF).

• Pascal source code: merge.p (wget instructions)
• Instructions on compiling
• MacOS binary: merge
• Alphabetic List of Delila Programs
• Delila Programs by Most Recent Update
• Please report broken links
• delilabundle.zip = All Programs and MacOS Binaries
• Copyright Statement for Delila Programs

Documentation for the merge program is below, with links to related programs in the "see also" section.

{version = 9.53; (* of merge 1989 May 1 *)}

(* begin module describe.merge *)
(*
name
      merge: compare two files and merge them

synopsis
      merge(afile: in, bfile: in, apfile: out, bpfile: out,
            output: out, input: intty)

files
      afile: the first input file
      bfile: the second input file
      apfile: the afile with corrections from bfile or the user
      bpfile: the bfile with corrections from afile or the user
      output: messages to the user
      input: interactive input from the user.

description
      the merge program was designed to aid in the entry of sequences.
      merge will also compare any two files for differences.
      two typed copies of the data are made (afile and bfile).  merge will
      compare the files, ignoring spaces and end-of-lines.  this allows
      the two data files to be typed independently by two people in two
      formats.  differences between the files are flagged, and the user
      may then indicate which file is correct and merge will fix the other
      file.  the user may also modify the files using a small
      editing facility.  the changes go to the prime files (apfile, bpfile).
      to be sure that apfile and bpfile are identical after the merge,
      you can merge them again.  several commands can be put on one line
      separated by blanks.  if you type an unrecognizable command, or ask for
      help at any time then merge will list the commands available.

examples
      when two sequences were compared, the program gave this output:
i am 91% sure that this has a deletion in b (insertion in a) of 5 characters:
file a: line 1
aatccttatccctcctaatttcgtttttgct
       >iiiii<        x         at 9 insertion, 1 mismatch downstream
file b: line 1
aatccttacctaatttcctttttgct
       ><        x         at 9 deletion, 1 mismatch downstream
      the sequences matched before the points indicated.  file a had
      an insert of "tccct" followed several bases later by a c to g change.
      the mismatch made merge less sure of the deletion.
      one must look at the original sequence to make the correction.

author
      thomas d. schneider

bugs
      1. lines without any characters are not copied from the file to its
      pfile.  see procedure readline.
      2. excessive blank characters may fool the guess procedure, since it
      does not remove blanks before guessing.  removing blanks would make
      it difficult to autofix, and the spacings would be lost in the pfile.
      3. the program can not compare more than one line from each file at a
      time,  so the guess is limited to what is visible on a line.  the entire
      program must be rewritten to allow multiple line guessing.
*)
(* end module describe.merge *)
{This manual page was created by makman 1.45}