From chenze@strawberry.ncifcrf.gov Wed Oct 25 21:30:48 2006 Received: from nihrelayxway.hub.nih.gov (nihrelayxway.hub.nih.gov [128.231.90.106]) by ncisun1.ncifcrf.gov (8.12.8p1/8.12.8) with ESMTP id k9Q1Ulee004901 for ; Wed, 25 Oct 2006 21:30:47 -0400 (EDT) Received: from mailfwd.nih.gov(128.231.90.106) by scm3300.ncifcrf.gov via smtp id 45f1_9b5a90ec_6491_11db_95ec_00142217583b; Wed, 25 Oct 2006 21:30:46 -0400 Received: from mail.ncifcrf.gov ([129.43.100.101]) by nihrelayxway.hub.nih.gov with ESMTP; 25 Oct 2006 21:30:47 -0400 X-IronPortListener: NIH_Relay X-SBRS: None X-IronPort-AV: i="4.09,358,1157342400"; d="scan'208"; a="450282991:sNHT20946496" Received: from mail.NCIFCRF.GOV(129.43.100.101) by scm3300.ncifcrf.gov via smtp id 46c0_9b315952_6491_11db_8bf4_00142217583b; Wed, 25 Oct 2006 21:30:47 -0400 Received: from strawberry.ncifcrf.gov (strawberry.NCIFCRF.GOV [129.43.6.74]) by mail.ncifcrf.gov (8.13.1/8.12.10) with ESMTP id k9Q1UlBx005698; Wed, 25 Oct 2006 21:30:47 -0400 Received: from localhost (chenze@localhost) by strawberry.ncifcrf.gov (8.12.10+Sun/8.12.10/Submit) with ESMTP id k9Q1UlTx020269; Wed, 25 Oct 2006 21:30:47 -0400 (EDT) Date: Wed, 25 Oct 2006 21:30:47 -0400 (EDT) From: Zehua Chen To: Karen Lewis cc: toms@alum.mit.edu Subject: Fur oligos (fwd) Message-ID: MIME-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII X-NAI-Spam-Score: -2.5 Status: ROr Karen, Here is the oligo list, but this list does not have exbB, exbD and fhuF. You should have those three, right? As I discussed with Tom a couple days ago, we may not need to show sequence walkers for all oligos. Our gel shift results (Fig 3) are in low resolution - from the gel we cannot tell how many dimers bind on each oligo. So we will not be able to correlate sequence walkers to the gel shifts. One thing we need to do is to include the natural binding sequences contined in all the oligos in the alignment shown in Supplementary Figure S1. The current Figure S1 (version 1.17) uses -15 to +15. We could keep this range for the 11 footprinted sites (marked by *), but we need to adjust the range for all other sites to make sure our alignment figure contains all binding sequences that are embeded in the oligos. Please let me know if this is easy for you to do. If not I will do it later. Zehua ---------- Forwarded message ---------- Date: Fri, 11 Apr 2003 14:18:20 -0400 (EDT) To: loramain@ncifcrf.gov Cc: tom , zehua Subject: Fur oligos (fwd) Hi Lora, Here is another oligo order for Oligos Etc. If possible, would you please give Oligos Etc. my email address so I receive the order confirmation? Tom got one from Synthegen, but he would prefer to have the companies just send them to me. Thanks, Danielle yahA: (scale: 1.00) 5' gctatcgcgcacagatatattaatgataatcactatcaccatatcgacgatcgcgcgaag cgcgatcgtcgatatggtgatagtgattatcattaatatatctgtgcgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) fadD: (scale: 1.00) 5' gctatcgcgtaccactatgataatcaatatcatatgggttacgatcgcgcgaagcgcgat cgtaacccatatgatattgattatcatagtggtacgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) neg-control: (scale: 1.00) 5' gctatcgcgtccagggtaatttcgaccactatttgctataacgatcgcgcgaagcgcgat cgttatagcaaatagtggtcgaaattaccctggacgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) yoeA: (scale: 1.00) 5' gctatcgcgaacataaatgaaaataattatcattacagtaatcatttgtactacgatcgc gcgaagcgcgatcgtagtacaaatgattactgtaatgataattattttcatttatgttcg cga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) oppA: (scale: 1.00) 5' gctatcgcgttctttattggtaatgagaataattaacaattaaagaacgatcgcgcgaag cgcgatcgttctttaattgttaattattctcattaccaataaagaacgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) nohA: (scale: 1.00) 5' gctatcgcgtatgtagatgataatcattatcactttacggacgatcgcgcgaagcgcgat cgtccgtaaagtgataatgattatcatctacatacgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) fepD-ybdA: (scale: 1.00) 5' gctatcgcgaacttccatgataatgaaattaattatcgttatcgatcttattacgatcgc gcgaagcgcgatcgtaataagatcgataacgataattaatttcattatcatggaagttcg cga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) gpmA: (scale: 1.00) 5' gctatcgcgcaatataatgagaattattatcattaaaagaacgatcgcgcgaagcgcgat cgttcttttaatgataataattctcattatattgcgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) gspC: (scale: 1.00) 5' gctatcgcgattatttttaatgtgaattatttccatacaaacgatcgcgcgaagcgcgat cgtttgtatggaaataattcacattaaaaataatcgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) yhaU: (scale: 1.00) 5' gctatcgcgggtaacaataaaaataatcagtaatattaaatagacgatcgcgcgaagcgc gatcgtctatttaatattactgattatttttattgttacccgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) yhhX-yhhY: (scale: 1.00) 5' gctatcgcgcgagacaataataatcattctcattcgcactacgatcgcgcgaagcgcgat cgtagtgcgaatgagaatgattattattgtctcgcgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) fhuA: (scale: 1.00) 5' gctatcgcgttatcttatctttataataatcattctcgtttacgttacgatcgcgcgaag cgcgatcgtaacgtaaacgagaatgattattataaagataagataacgcga 3' 0001 DNA Synthesis 0200 PAGE Purification (2-Step) ----- End of forwarded message from needled ----- -- Danielle Needle Building 469, Room 144 Frederick, MD 21702 phone: 301-846-5581 fax: 301-846-5598 From toms Wed Oct 25 23:57:02 2006 To: Karen.Lewis@UTSouthwestern.edu, chenze@ncifcrf.gov, lewiska@ncifcrf.gov Subject: missing, renamed Fur sites Content-Length: 411 Karen and Zehua: I rearranged the oligos from the ordering list so that they match the figure and found several things don't match: 1. There are two extra oligos not listed on the figure: yhhX-yhhY neg-control What are the correct names for these? 2. Five oligos are missing, for which I need sequences: ryhB ygaC exbB exbD fhuF Obviously the extra ones may match two of the missing ones. Thanks, Tom