sebo 1.41 search with book";
sebop parameters:
f: force alignment on first base
       -10         50 range of book alignment used for search
         0         50 range of resulting output instructions
         6            mismatches allowed
    500000            alert interval

Target sequence: 
piece NC_000913; get from 1 to 4639675 direction +; { 4639675 bases }
   Searching target 1 with probe 1: 
name "gpmA"; piece gpmA; get from 31 to 1 direction -;

   -                   +++++++++++++++++++++++++++++++++++++++++
   1--------- +++++++++11111111112222222222333333333344444444445
   0987654321012345678901234567890123456789012345678901234567890
             tcttttaatgataataattctcattatattg                     probe
             ^ found at 786838 on the target

   Searching target 1 with probe 2: 
name "nohA"; piece nohA; get from 31 to 1 direction -;

   -                   +++++++++++++++++++++++++++++++++++++++++
   1--------- +++++++++11111111112222222222333333333344444444445
   0987654321012345678901234567890123456789012345678901234567890
             ccgtaaagtgataatgattatcatctacata                     probe
             ^ found at 1634609 on the target

total probes found: 2