sebo 1.43 search with book";
sebop parameters:
f: force alignment on first base
       -10         50 range of book alignment used for search
a                     ABSOLUTE instructions
         3            mismatches allowed
         6            alert interval

Target sequence: 
name "gpmA"; piece NC_000913; get from 786788 to 786888 direction +; { 101 bases }
   Searching target 1 with probe 1: 
name "gpmA"; piece gpmA; get from 31 to 1 direction -;

   -                   +++++++++++++++++++++++++++++++++++++++++
   1--------- +++++++++11111111112222222222333333333344444444445
   0987654321012345678901234567890123456789012345678901234567890
             tcttttaatgataataattctcattatattg                     probe
             ^ found at 786838 on the target

   Searching target 1 with probe 2: 
name "nohA"; piece nohA; get from 31 to 1 direction -;
{ probe "nohA" was not found in the target. }

Target sequence: 
name "nohA"; piece NC_000913; get from 1634559 to 1634659 direction +; { 101 bases }
   Searching target 2 with probe 1: 
name "gpmA"; piece gpmA; get from 31 to 1 direction -;
{ probe "gpmA" was not found in the target. }
   Searching target 2 with probe 2: 
name "nohA"; piece nohA; get from 31 to 1 direction -;

   -                   +++++++++++++++++++++++++++++++++++++++++
   1--------- +++++++++11111111112222222222333333333344444444445
   0987654321012345678901234567890123456789012345678901234567890
             ccgtaaagtgataatgattatcatctacata                     probe
             ^ found at 1634609 on the target

total probes found: 2